RNA Lib Prep 384 CDI Primer for Illumina, Set 1 (96 index) _ N210733

RNA Lib Prep 384 CDI Primer for Illumina is a dedicated adapter primer kit for RNA library preparation on the IlluminaTM high-throughput sequencing platform. It is divided into 2 Sets, each containing PE adapters used in second-generation sequencing library preparation, as well as 8 types of i5 Index Primers and 12 types of i7 Index Primers. The two Sets provide a total of 16 types of i5 Index Primers and 24 types of i7 Index Primers, which can be combined to construct up to 384 different combinations of dual-indexed libraries when used with Arcegen's RNA library preparation kits. All reagents provided in the kit have undergone strict quality control and functional validation to ensure maximum stability and reproducibility in library preparation. Specifications Cat.No. N210733S Size 96×2T Components Components No. Name N210733S N210733 PE Adapter 320 μL RP 501-508 60 μL each RP 701-712 40 μL each Storage Shipped with ice packs. All components should be stored at -25°C ~ -15°C, valid for 18 months. Notes 1. The concentration of PE Adapter in this kit is 15 μM, and the amount used for individual library preparation should be adjusted according to the recommended usage volume of the library preparation kit being used. The concentration of Index Primers is 10 μM. 2. The PE Adapter provided in this kit is a universal short adapter, requiring PCR amplification to obtain a complete library. Index Primers provide index sequences for distinguishing samples during high-throughput sequencing. 3. Each Set contains 8 types of i5 Index Primers (RP 5xx) and 12 types of i7 Index Primers (RP 7xx), which can combine to construct 96 different combinations of dual-indexed libraries. Two Sets together provide 16 types of i5 Index Primers and 24 types of i7 Index Primers. You may use the i5 Index Primer (or i7 Index Primer) from Cat#N210733 with the i7 Index Primer (or i5 Index Primer) from Cat#n210734 to construct up to 384 different combinations of dual-indexed libraries. 4. Do not heat the adapters; they should be allowed to slowly dissolve at room temperature, ideally set between 20-25 °C. Avoid repeated freeze-thaw cycles of adapters and suggest aliquoting for storage; they can be briefly stored at 4 °C. 5. The structure of the sequencing library constructed using the RNA Lib Prep 384 CDI Primer for Illumina kit is as follows: 6. For your safety and health, please wear lab coats and disposable gloves during operation. 7. This product is for research use only! Sequence Information PE Adapter for Illumina: 5´-/5Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGTC -3´ 5´-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´ i5 Index Primer for Illumina: 5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3´ i7 Index Primer for Illumina: 5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´ [i5 Index] indicates an 8 bp i5 Index sequence, [i7 Index] indicates an 8 bp i7 Index sequence. The name of each primer corresponding to the Index, the Index sequence contained within the primer, and the Index sequence information corresponding to sequencing are shown in the table below: I5 Index Primers Primer Sequence Sample Sheet Input/Sequencing Index Sequence NovaSeq 6000 v1.0 reagents, MiSeq, HiSeq 2000/2500 NovaSeq 6000 v1.5 reagents， MiniSeq, NextSeq, HiSeq 3000/4000 RP501 TATAGCCT TATAGCCT AGGCTATA RP502 ATAGAGGC ATAGAGGC GCCTCTAT RP503 CCTATCCT CCTATCCT AGGATAGG RP504 GGCTCTGA GGCTCTGA TCAGAGCC RP505 AGGCGAAG AGGCGAAG CTTCGCCT RP506 TAATCTTA TAATCTTA TAAGATTA RP507 CAGGACGT CAGGACGT ACGTCCTG RP508 GTACTGAC GTACTGAC GTCAGTAC RP509 GACCTGTA GACCTGTA TACAGGTC RP510 ATGTAACT ATGTAACT AGTTACAT RP511 GTTTCAGA GTTTCAGA TCTGAAAC RP512 CACAGGAT CACAGGAT ATCCTGTG RP513 TAGCTGCC TAGCTGCC GGCAGCTA RP514 AGCGAATG AGCGAATG CATTCGCT RP515 TATGCTGC TATGCTGC GCAGCATA RP516 AGAAGACT AGAAGACT AGTCTTCT   I7 Index Primers Primer Sequence Sample Sheet Input/Sequencing Index Sequence RP701 CGAGTAAT ATTACTCG RP702 TCTCCGGA TCCGGAGA RP703 AATGAGCG CGCTCATT RP704 GGAATCTC GAGATTCC RP705 TTCTGAAT ATTCAGAA RP706 ACGAATTC GAATTCGT RP707 AGCTTCAG CTGAAGCT RP708 GCGCATTA TAATGCGC RP709 CATAGCCG CGGCTATG RP710 TTCGCGGA TCCGCGAA RP711 GCGCGAGA TCTCGCGC RP712 CTATCGCT AGCGATAG RP713 CCTACACG CGTGTAGG RP714 GTAGTGTC GACACTAC RP715 TGTATGCA TGCATACA RP716 CCAGACTG CAGTCTGG RP717 AGGTGCCA TGGCACCT RP718 TCACCTTG CAAGGTGA RP719 GTATCTTT AAAGATAC RP720 CAGCTCCA TGGAGCTG RP721 TCGCCTTA TAAGGCGA RP722 CTAGTACG CGTACTAG RP723 AGCGTAGC GCTACGCT RP724 GAGCCTCG CGAGGCTC Documents: Manuals